DRAGoM

DRAGoM is a tool designed to predict and assemble ncRNA from next generation sequencing data.

DRAGoM is written in C++ and has been tested on a 64-bit Linux system.

DRAGoM is freely available under the Creative Commons BY-NC-ND 4.0 License Agreement (https://creativecommons.org/licenses/by-nc-nd/4.0/).

For other operating system, user need to install the third party softwares and update the "env.config" file as described in Installation.

The input for DRAGoM includes:

1. raw reads, pair-end or single-end, trim if necessary;

2. CM files of interested ncRNA from Rfam(https://rfam.xfam.org)

The output of DRAGoM includes:

1. summary.csv: which summarized the read counts for each ncRNA family;

2. predicted reads for each ncRNA family in seperate file;

3. assembled ncRNA homologs for each ncRNA family in seperate file;

Prerequisites:

1. g++ compiler ( >= 4.8.5)

2. boost ( >= 1.53)

3. python 2.7

4. make ( >= 3.82)

5. cmake ( >= 3.12)

 

Third-party software:

1. sga (https://github.com/jts/sga)

2. SPAdes (https://cab.spbu.ru/software/spades/)

3. bwa (http://bio-bwa.sourceforge.net)

4. infernal (http://eddylab.org/infernal/)

5. cd-hit (http://weizhongli-lab.org/cd-hit/)

6. samtools (http://www.htslib.org)

 

Note:

1. You must install the prerequisites to successfully run DRAGoM.

2. We provided one set of pre-built binary of all third-party softwares with DRAGoM.

If you prefer to use another version of any third-party software, remember to update the env.config file.

3. We have tested the softwares on Red hat ( > 7 ) and Ubuntu ( > 18.04 ), if you are going to use DRAGoM on other OS, you might need to install the third-party softwares on your own.

Installation:

To install DRAGoM, please follow the steps below:

1. Untar the downloaded file "DRAGoM.tar.gz". This will generate the directory "DRAGoM".

$ tar xzvf DRAGoM.tar.gz

2. Install DRAGoM by running the "install.sh" script.

$ bash install.sh

 

Note:

1. An 'env.config' file will be created automatically after runninng 'install.sh', which contains the absolute directory to all executable of all third-party softwares.

If you want to use another version, update the corresponding directory to the executable you want DRAGoM to use.

2. The 'cmsearch' and 'cmpress' are included in the software infernal.

 

For users using other operating system, you should:

1. install all third party software following their installation;

2. update "env.config";

3. compile DRAGoM main program by:

$ cd ~/src/

$ make clean

$ make

 

Running the program:

The runDragom.py wrapper is used to run the DRAGoM.

USAGE: python2 runDragom.py [options]

Input options:

-1 : fastq file with forward paired-end reads

-2 : fastq file with reverse paired-end reads

only use -1 means that input reads are interleaved paired-end reads

-s : fastq file with single-end reads

if both pair-end or single-end input are provided, the single-end input will be ignored

-p : parameter file

-m : [optional] maximum extension length for anchors [default: 100]

-d : [optional] disable anchor masking [default: not use]

-k : [optional] keep and gzip all intermediate files [default: not use]

-h : print help message

 

Note:

1.The parameter file specifies the parameters used for running all programs including in DRAGoM;

2.The parameter file must contain the path to input CM files;

3.You must provide at least one cm file to run the program;

4.Don't change the parameters if you don't understand what it means.

Example:

An example of simulated pair-end reads file is provided in the ~/example/ directory.

You can use the example to test the installation using:

$ cd ~/example/

$ python2 ../runDragom.py -1 example.read1.fq -2 example.read2.fq -p example.config

 

Note:

you might need to unzip the example file using:

$ tar -xvf example.tar.gz

 

Output:

The final output of the example should contain 5 files.

1. summary.csv, this file summarized the read counts for each ncRNA family:

(Note this is a csv file)

acc,predicted reads,name

RF00002,11,5_8S_rRNA

RF00010,21,RNaseP_bact_a

 

2, RF00010.assembled_rna.fa, this file listed all homologs of RF00010:

E.g.

>24,39,1,100,7,67,100_0_166_5.8e-28_RF00010

TGGATGATAGATGGAGGAGAGGAAAGTCCGGGCTCCACAGGGCAGGGTGCCAGATAACGTGTGGGGGGTGAAAGCCCACGACCAGTGCAACAGAGAGCAA

ACCGCCGATGGCTTACTTAATGTAGGATCAGGTAAGGGTGAACGGGTGCGGTAAGAGCGCACCGCA

>69,1,1,100_27_404_6.7e-98_RF00010

GGAGTTGACTAGACATTCGCTGCTTTATCATTAATCCTTTGGATGATAGATGGAGGAGAGGAAAGTCCGGGCTCCACAGGGCAGGGTGCCAGATAACGTC

TGGGGGGTGAAAGCCCACGACCAGTGCAACAGAGAGCAAACCGCCGATGGCTTACTTAATGTAGGATCAGGTAAGGGTGAAAGGGTGCGGTAAGAGCGCA

CCGCACGGCTGGTAACAGTTCGTGGCACGGTAAACTCCACTCGGAGCAAGGCCAAATAGGGGTTCATTAGGTACGGCCCGTATCGAACCCGGGTAGGCTG

CTTGAGCCAGTGCGTAAGTGCTGGCCTAGATGAATGATTGTCCACGACAGAACCCGGCTTATCGGTCAACTTCACAA

 

3. RF00010.prediction.csv, this file listed all predicted reads for RF00010:

(Note this is a csv file)

E.g.

Read_Header,E-value

test_203_341_0:0:0_1:0:0_16/1,6.7e-98

test_114_297_2:0:0_0:0:0_9/1,6.7e-98

test_114_297_2:0:0_0:0:0_9/2,6.7e-98

 

4, RF00002.assembled_rna.fa, this file listed all homologs of RF00002:

E.g.

>4,33,1,100,11,53,100,43,92,100,49,105,100_123_204_6e-11_RF00002

GACTCTCGGCAACGGATATCTTGCTCTCGCATCGATGAAGAACGTAGCGAAATGCGATACTTGGTGTGAATTGCAAGATCC

>12,58,1,100,4,16,100,46,46,100,9,85,100,57,117,100_130_216_1.2e-16_RF00002

AACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGGGAATTGCAGAATTCAGTG

 

5. RF00002.prediction.csv, this file listed all predicted reads for RF00002:

(Note this is a csv file)

E.g.

Read_Header,E-value

test_543_727_0:0:0_2:0:0_2/2,1.2e-16

test_512_722_1:0:0_2:0:0_b/1,1.2e-16

test_853_1013_1:0:0_3:0:0_0/2,6e-11

 

If you found DRAGoM useful, please cite the following paper:

 

---

 

Contact: Cuncong Zhong (cczhong@ku.edu) or Ben Liu (ben_0522@ku.edu)

 

 

The authors would like to acknowledge that DRAGoM includes (part of) the BOOST library (htt://www.boost.org).

The authors would like to acknowledge that DRAGoM includes third-party softwares:

1. sga (https://github.com/jts/sga)

2. SPAdes (https://cab.spbu.ru/software/spades/)

3. bwa (http://bio-bwa.sourceforge.net)

4. infernal (http://eddylab.org/infernal/)

5. cd-hit (http://weizhongli-lab.org/cd-hit/)

6. samtools (http://www.htslib.org)